circad | circRNAs associated with diseases

hsa_circRNA_000992
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Pituitary Adenomas	ICD-10	- (-)
DBLink		PMID	31261542
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Tumor samples were obtained from patients who underwent transsphenoidal surgery or craniotomy for NFPA resection
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward tgcatacagtttcatttctactg Reverse ctgacatatagttagccttttg	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Hu, Y, Zhang, N, Zhang, S, Zhou, P, Lv, L, Richard, SA, Ma, W, Chen, C, Wang, X, Huang, S, Jiang, S (2019). Differential circular RNA expression profiles of invasive and non-invasive non-functioning pituitary adenomas: A microarray analysis. Medicine (Baltimore), 98, 26:e16148.